Skip to content

Targetedlibrary

Targetedlibrary

  • Home
  • Sample Page
    • Home
    • Uncategorized
    • Page 88
Uncategorized

Stereoselective Construction of Carbocyclic Rings

Chemexpress March 28, 2024 0 Comments

Carbocyclic rings, unlike saturated heterocyclic rings, are not susceptible to the hepatic activation that is the basis of much drug toxicity. To pave the way for pharmaceutical discovery based on…

Uncategorized

Oxidation: The Hong/Gui Synthesis of Bufospirostenin A

Chemexpress March 28, 2024 0 Comments

Oleg V. Larionov of the University of Texas at San Antonio devised a protocol for the decarboxylative coupling of an acid 1 with an arenesulfinate 2 to give the sulfoxide…

Uncategorized

Metal-Mediated C-C Ring Construction: The Li Synthesis of Bufogargarizin A

Chemexpress March 28, 2024 0 Comments

Christopher Uyeda of Purdue University achieved high enantioselectivity in the cyclopropanation of myrcene (1) with 2,2-dichloropropane (2) to give 3 (J. Am. Chem. Soc. 2023, 145, 9441. DOI: 10.1021/jacs.3c01949). Qinglei…

Uncategorized

C-N Ring Construction: The Louie Synthesis of Septicine

Chemexpress March 28, 2024 0 Comments

Malte Brasholz of the University of Rostock developed a protocol for the photochemically-driven in situ oxidation of the quinoxalinone 1 followed by cycloaddition with methacrylonitrile 2 to give the azetidine…

Uncategorized

Enantioselective Synthesis of Alcohols and Amines: The Zhang/Tu Synthesis of Eupomatilone-6

Chemexpress March 28, 2024 0 Comments

Vicente Gotor-Fernández and Iván Lavandera of the Universidad de Oviedo optimized the enzymatic reduction of the chloroketone 1 to the chlorohydrin 2, then telescoped that to begin with the 1-chloroalkyne…

Uncategorized

two.five L) and terminal TdT (25 Units) in buffer (Promega, Madison, WI). Cellspecific

Chemexpress March 27, 2024 0 Comments

two.five L) and terminal TdT (25 Units) in buffer (Promega, Madison, WI). Cellspecific immunohistochemical labeling was performed as previously described (Guyton et al. 2009). Briefly, before primary antibody staining, nonspecific…

Uncategorized

The logistic regression analysis revealed that getting an injection drug user

Chemexpress March 27, 2024 0 Comments

The logistic regression evaluation revealed that being an injection drug user (IDU) was substantially related to HCV infection. Having said that, contrary to the majority of the existing literature, getting…

Uncategorized

Substituted Benzenes: The Newhouse Synthesis of Shearilicine

Chemexpress March 27, 2024 0 Comments

Haibo Ge of Texas Tech University and Debabrata Maity of the Indian Institute of Technology Bombay effected the m-acetoxylation of the ester 1, leading to 2 (JACS Au 2023, 3,…

Uncategorized

C-O Ring Construction: The Liu/Wang Synthesis of Miharimycin B

Chemexpress March 27, 2024 0 Comments

Mark G. 259214-55-6 uses McLaughlin of the University of Lancaster found that under alkaline conditions, the alcohol 1 could be cyclized to the iodo oxetane 2 (Chem. Commun. 2022, 58,…

Uncategorized

C-O Ring Construction: The Fuwa Synthesis of Exiguolide

Chemexpress March 27, 2024 0 Comments

Arjan W. Kleij of ICIQ optimized an aluminum catalyst for the conversion of the bis epoxide 1 to the oxetane 2 (ACS Catal. PMID:23399686 2022, 12, 5464. DOI: 10.1021/acscatal.2c00925). A.…

Posts pagination

1 … 87 88 89 … 101

« Previous Page — Next Page »

Recent Posts

  • Age). Similarly, a rise of ATX mRNA expression was observed in
  • Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages
  • Lity of detecting an association with homocysteine, if any. The mechanism
  • three). Nonetheless, there was only a tendency to minimize the combined incidences
  • TCCCTGCCAGATATCGAC GATGCACAGCAGGAGGATTT TACCATCTACCTGGGCTTCG CCATTCTGATTTGCTGCCTTAT GATCTCAGTGCAGAGGCTCG CCTTCCTGCTGCGGTTCA ATACCGGCACGAGACCGATAGTCA ATCAAACCCCCTGCAAGTGT AGCTGCTCAAGGCTTCCTTAT GACCCCAAGGAGATCACATTCACG GGCTAGAAATCTGCCTGTGC

Recent Comments

  1. A WordPress Commenter on Hello world!

You Missed

Uncategorized

Age). Similarly, a rise of ATX mRNA expression was observed in

Uncategorized

Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages

Uncategorized

Lity of detecting an association with homocysteine, if any. The mechanism

Uncategorized

three). Nonetheless, there was only a tendency to minimize the combined incidences

Targetedlibrary

Copyright © All rights reserved | Blogus by Themeansar.