Skip to content

Targetedlibrary

Targetedlibrary

  • Home
  • Sample Page
    • Home
    • Uncategorized
    • Page 99
Uncategorized

Functional Group Interconversion: The Fuwa Synthesis of Enigmazole A

Chemexpress March 15, 2024 0 Comments

N. Gabriel Lemcoff of the Ben-Gurion University of the Negev and Ofer Reany of the Open University of Israel used a thiourea to catalyze the N-bromosuccinimide conversion of the alcohol…

Uncategorized

Other Methods for Carbocyclic Construction: Isoscopariusin A (Li/Puno), Pleosporol A (Xu), Altemicidin (Maimone), Dysideanone B (Lu), Stephadiamine (Nagasawa), Shikoccin (Ding)

Chemexpress March 15, 2024 0 Comments

Léon Ghosez demonstrated that cycloaddition was particularly efficient with keteniminum salts. Ang Li of the Shanghai Institute of Organic Chemistry and Pema-Tenzin Puno of the Kunmin Institute of Botany extended…

Uncategorized

C-C Bond Formation: The Chen/Yang Synthesis of Spirochensilide A

Chemexpress March 15, 2024 0 Comments

Patrick J. Walsh of the University of Pennsylvania and Jianyou Mao of Nanjing Tech University assembled the carboxylic acid 3 by the decarboxylative coupling of glutaric anhydride 2 with the…

Uncategorized

Arrays of Sterogenic Centers: The Inoue Synthesis of Hikizimycin

Chemexpress March 15, 2024 0 Comments

Chi-Ming Che of the University of Hong Kong designed an Fe catalyst that mediated the enantioselective dihydroxylation of the unsaturated ester 1, delivering the diol 2 (Angew. Chem. Int. 87789-35-3…

Uncategorized

Reactions of Alkenes: The Park Synthesis of Nitramine

Chemexpress March 15, 2024 0 Comments

Gong-Qing Liu and Yong Ling of Nantong University prepared the selenyl alcohol 2 by the oxidative addition of diphenyl diselenide to the alkene 1 (J. Org. PMID:24580853 Chem. 2021, 86,…

Uncategorized

Essed; E mail: [email protected]; Tel.: 6096684961; Fax: 6096684949. Received: 17 June 2013; in

Chemexpress March 14, 2024 0 Comments

Essed; E-mail: [email protected]; Tel.: 6096684961; Fax: 6096684949. Received: 17 June 2013; in revised kind: 14 August 2013 / Accepted: 23 August 2013 / Published: 20 SeptemberAbstract: The objective of this…

Uncategorized

Ational pharmaceutical companies to style and manufacture novel carbohydratebased drugs. While

Chemexpress March 14, 2024 0 Comments

Ational pharmaceutical companies to design and style and manufacture novel carbohydratebased drugs. Even though a number of glycans have therapeutic properties these of marine origin possess a unique position. This…

Uncategorized

“CuH in a Bottle” for Asymmetric Hydrosilylations

Chemexpress March 14, 2024 0 Comments

Bruce H. PMID:24278086 Lipshutz and Bryan A. Frieman from the University of California, Santa Barbara, have made investigations on as a hydrosilylation reagent regarding stability and preparation (Angew. 1450752-97-2 Formula…

Uncategorized

Oxidation: The Sherman/Williams Synthesis of Baulamycin A

Chemexpress March 14, 2024 0 Comments

Zhankui Sun of Shanghai Jiao Tong University devised photolytic conditions for the oxidation of the acid 1 to the alcohol 2 (J. Org. Chem. 2020, 85, 5019. DOI: 10.1021/acs.joc.0c00312). Kazunori…

Uncategorized

Diels-Alder Cycloaddition: 4β-Acetoxyprobotryane-9β,15α-diol (Li), Penostatin C (Tong), Sucutinirane C (Pitsinos), Glaucocalyxin A (Jia), PF-1018 (Trauner), Abyssomycin C (Vidali)

Chemexpress March 14, 2024 0 Comments

4β-Acetoxyprobotryane-9β,15α-diol (3) was isolated from the wine grape necrotrophic fungus Botrytis cinerea. En route to 3, Chuang-Chuang Li of the Southern University of Science and Technology optimized the Rh-catalyzed cycloaddition…

Posts pagination

1 … 98 99 100 101

« Previous Page — Next Page »

Recent Posts

  • Age). Similarly, a rise of ATX mRNA expression was observed in
  • Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages
  • Lity of detecting an association with homocysteine, if any. The mechanism
  • three). Nonetheless, there was only a tendency to minimize the combined incidences
  • TCCCTGCCAGATATCGAC GATGCACAGCAGGAGGATTT TACCATCTACCTGGGCTTCG CCATTCTGATTTGCTGCCTTAT GATCTCAGTGCAGAGGCTCG CCTTCCTGCTGCGGTTCA ATACCGGCACGAGACCGATAGTCA ATCAAACCCCCTGCAAGTGT AGCTGCTCAAGGCTTCCTTAT GACCCCAAGGAGATCACATTCACG GGCTAGAAATCTGCCTGTGC

Recent Comments

  1. A WordPress Commenter on Hello world!

You Missed

Uncategorized

Age). Similarly, a rise of ATX mRNA expression was observed in

Uncategorized

Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages

Uncategorized

Lity of detecting an association with homocysteine, if any. The mechanism

Uncategorized

three). Nonetheless, there was only a tendency to minimize the combined incidences

Targetedlibrary

Copyright © All rights reserved | Blogus by Themeansar.