Skip to content

Targetedlibrary

Targetedlibrary

  • Home
  • Sample Page
    • Home
    • Uncategorized
    • Page 95
Uncategorized

Substituted Benzenes: The Yang/Zhang Synthesis of Cephanolide B

Chemexpress March 21, 2024 0 Comments

Duen-Ren Hou of the National Central University devised a simple protocol for the direct acetoxylation of the substituted benzene 1, leading to the aryl acetate 2 (Org. Lett. 2021, 23,…

Uncategorized

Organometallic C-C Ring Construction: The Nishikawa/Morimoto Synthesis of Toxicodenane A

Chemexpress March 21, 2024 0 Comments

Xihe Bi of Northeast Normal University showed that the diazo alkane generated in situ from the sulfonylhydrazide 2 could with a silver catalyst be added to the alkene 1, to…

Uncategorized

Oxidation: The Cossy/Amara Route to Artemisinin

Chemexpress March 21, 2024 0 Comments

Chen Xu of the Southern University of Science and Technology and Zheng Huang of the Shanghai Institute of Organic Chemistry effected the acceptorless photochemical dehydrogenation of the sulfide 1 to…

Uncategorized

Enantioselective Synthesis of Alcohols and Amines: The Yajima Synthesis of 1,3,5-Bisabolatrien-7-ol

Chemexpress March 21, 2024 0 Comments

Aaron Aponick of the University of Florida achieved high ee in the cyclization of the allylic alcohol 1 to the lactone 2 (Angew. Chem. Int. Ed. 2021, 60, 22224. DOI:…

Uncategorized

C-N Ring Construction: The del Pozo Synthesis of Myrtine

Chemexpress March 21, 2024 0 Comments

Tom G. Driver of the University of Illinois at Chicago developed oxidative conditions for the preparation of the aziridine 3 by the addition of the aniline 2 to the alkene…

Uncategorized

N was performed by the identical men and women as inside the preceding

Chemexpress March 20, 2024 0 Comments

N was performed by the exact same people as within the preceding study (Hermann et al., 2012). Feasible elements incorporate the use of a rather higher dose of radiation in…

Uncategorized

Ret C, Dorel C, Hooreman M, Lejeune P (1998) Isolation of an

Chemexpress March 20, 2024 0 Comments

Ret C, Dorel C, Hooreman M, Lejeune P (1998) Isolation of an Escherichia coli K12 mutant strain able to type biofilms on inert surfaces: Involvement of a brand new ompR…

Uncategorized

Substituted Benzenes: The Zhai Synthesis of Cephanolide B

Chemexpress March 20, 2024 0 Comments

Shangda Li and Gang Li of the Fujian Institute of Research on the Structure of Matter used the iodo nitro aromatic 2 to selectively iodinate the anilide 1, leading to…

Uncategorized

C-O Ring Construction: The Makabe Synthesis of Muconin

Chemexpress March 20, 2024 0 Comments

Yu-Fei Ao and Hui Chen of the Institute of Chemistry, Chinese Academy of Sciences devised a mutant amidase that hydrolyzed the prochiral dihydrofuran bis amide 1 to the monoacid 2…

Uncategorized

C-O Ring Construction: The Ito Synthesis of Callilongisin B

Chemexpress March 20, 2024 0 Comments

Young Ho Rhee of the Pohang University of Science and Technology assembled the dihydrofuran 3 by Pd-mediated coupling of the allene 1 with the keto acid 2, followed by ring-closing…

Posts pagination

1 … 94 95 96 … 101

« Previous Page — Next Page »

Recent Posts

  • Age). Similarly, a rise of ATX mRNA expression was observed in
  • Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages
  • Lity of detecting an association with homocysteine, if any. The mechanism
  • three). Nonetheless, there was only a tendency to minimize the combined incidences
  • TCCCTGCCAGATATCGAC GATGCACAGCAGGAGGATTT TACCATCTACCTGGGCTTCG CCATTCTGATTTGCTGCCTTAT GATCTCAGTGCAGAGGCTCG CCTTCCTGCTGCGGTTCA ATACCGGCACGAGACCGATAGTCA ATCAAACCCCCTGCAAGTGT AGCTGCTCAAGGCTTCCTTAT GACCCCAAGGAGATCACATTCACG GGCTAGAAATCTGCCTGTGC

Recent Comments

  1. A WordPress Commenter on Hello world!

You Missed

Uncategorized

Age). Similarly, a rise of ATX mRNA expression was observed in

Uncategorized

Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages

Uncategorized

Lity of detecting an association with homocysteine, if any. The mechanism

Uncategorized

three). Nonetheless, there was only a tendency to minimize the combined incidences

Targetedlibrary

Copyright © All rights reserved | Blogus by Themeansar.