Skip to content

Targetedlibrary

Targetedlibrary

  • Home
  • Sample Page
    • Home
    • Uncategorized
    • Page 90
Uncategorized

The Chen/Wang Synthesis of Retigeranic Acid

Chemexpress March 26, 2024 0 Comments

Retigeranic acid (3), isolated from the Western Himalayas lichen Lobaria retigera, presents a variety of intriguing architectural challenges. Xiaoming Chen and Shao-Hua Wang of Lanzhou University devised a concise route…

Uncategorized

The Dai Synthesis of Peyssonnoside A

Chemexpress March 26, 2024 0 Comments

Peyssonnoside A (3), isolated from the red alga Peyssonnelia sp., shows promising anti-microbial activity. PMID:24275718 Mingji Dai of Emory University assembled the tetracyclic core of 3 by the H-atom transfer…

Uncategorized

The Garg Synthesis of Lissodendoric Acid A

Chemexpress March 26, 2024 0 Comments

Lissodendoric acid A (4), isolated from the marine sponge Lissodendoryx florida, reduced reactive oxygen species (ROS) in a Parkinson’s disease model. Fmoc-β-HoGlu(OtBu)-OH Chemscene Neil K. Garg of UCLA devised an…

Uncategorized

The Zhao/Ma Synthesis of Napelline

Chemexpress March 26, 2024 0 Comments

Napelline (3) was isolated from Aconitum kusnezoffii, a widely-cultivated herbaceous perennial that, despite its toxicity, has long been used in traditional medicine. Xiangbo Zhao and Dawei Ma of SIOC assembled…

Uncategorized

The Li Synthesis of Albolic Acid

Chemexpress March 26, 2024 0 Comments

Albolic acid (3) and ceroplastol II, the corresponding primary alcohol, are sesterterpenoids isolated from the wax secretion of Ceroplastes albolineatus, a scale insect. Chuang-Chuang Li of the Southern University of…

Uncategorized

Carbon-Carbon Bond Construction: The Houk/Qu/Yu Synthesis of Spirooliganin

Chemexpress March 26, 2024 0 Comments

Yan Qi and Yongjun Liu of the Qingdao University of Science and Technology demonstrated that the assembly of the tertiary alcohol 3 by the Barbier coupling of cyclohexanone 1 with…

Uncategorized

C-H Functionalization: The Shaw Synthesis of Panowamycin B

Chemexpress March 26, 2024 0 Comments

Qingtao Meng and Zhiqiang Zhang of the University of Science and Technology Liaoning and Yu-Peng He of the Dalian University of Technology used the amide of 1 to direct acetoxylation,…

Uncategorized

Heterocycle Construction by Grubbs Metathesis

Chemexpress March 26, 2024 0 Comments

Grubbs metathesis has proven to be a powerful tool for the rapid construction of complex heterocycles. Shengming Ma of the the Shanghai Institute of Organic Chemistry reports (J. Org. Methyl…

Uncategorized

Carbon-Carbon Bond Formation: The Houk/Cai Synthesis of Artemisinin

Chemexpress March 26, 2024 0 Comments

Following the Wenkert approach, Jun Huang and Zhen Yang of Peking University prepared the alkylated aldehyde 2 by conversion of the aldehyde 1 to the silyl enol ether, followed by…

Uncategorized

Other Methods for Carbocyclic Construction: Piperarborenine B (Antonchick), Nakafuran-8 (Houk/Li), Cochlearol B (Sugita), Talatisamine (Reisman), Berkeleyone A (Li), Prostratin (Inoue)

Chemexpress March 26, 2024 0 Comments

Piperarborenine B (3), isolated from the stem of Piper arborescens, shows significant and selective antineoplastic activity. 2-(4,4-Difluorocyclohexyl)acetic acid site Andrey P. Antonchick of Nottingham Trent University constructed the cyclobutane core…

Posts pagination

1 … 89 90 91 … 101

« Previous Page — Next Page »

Recent Posts

  • Age). Similarly, a rise of ATX mRNA expression was observed in
  • Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages
  • Lity of detecting an association with homocysteine, if any. The mechanism
  • three). Nonetheless, there was only a tendency to minimize the combined incidences
  • TCCCTGCCAGATATCGAC GATGCACAGCAGGAGGATTT TACCATCTACCTGGGCTTCG CCATTCTGATTTGCTGCCTTAT GATCTCAGTGCAGAGGCTCG CCTTCCTGCTGCGGTTCA ATACCGGCACGAGACCGATAGTCA ATCAAACCCCCTGCAAGTGT AGCTGCTCAAGGCTTCCTTAT GACCCCAAGGAGATCACATTCACG GGCTAGAAATCTGCCTGTGC

Recent Comments

  1. A WordPress Commenter on Hello world!

You Missed

Uncategorized

Age). Similarly, a rise of ATX mRNA expression was observed in

Uncategorized

Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages

Uncategorized

Lity of detecting an association with homocysteine, if any. The mechanism

Uncategorized

three). Nonetheless, there was only a tendency to minimize the combined incidences

Targetedlibrary

Copyright © All rights reserved | Blogus by Themeansar.