Skip to content

Targetedlibrary

Targetedlibrary

  • Home
  • Sample Page
    • Home
    • Uncategorized
    • Page 94
Uncategorized

C-O Ring Construction: Burseran (Tanaka), Hyperione A (Dai), Spirotenuipesine A (Imagawa), Stachyodin A (Ito), Alstilobanine C Zhu), Biselide A (Britton)

Chemexpress March 22, 2024 0 Comments

The sap from the elephant tree of northern Mexico, Bursera microphylla, was used locally as a cure-all for diseases, particularly those affecting the skin. Hiroshi Tanaka of the Tokyo University…

Uncategorized

Heteroaromatics: The Cho Synthesis of Decursivine

Chemexpress March 22, 2024 0 Comments

Marie-Isabelle Lannou and Geoffroy Sorin of the Université de Paris used Ag2O to cyclize the alkyne 1 to the furan 2 (Chem. Commun. 2022, 58, 1374. DOI: 10.1039/D1CC06379K). Rishikesh Narayan…

Uncategorized

C-N Ring Construction: The Karimov Synthesis of a Nuphar Alkaloid

Chemexpress March 22, 2024 0 Comments

Weidi Cao and Xiaoming Feng of Sichuan University achieved high enantioselectivity in the ring expansion of the racemic aziridine with the isonitrile 2 to give the azetidine 3 (Org. Lett.…

Uncategorized

Organocatalyzed C-C Ring Construction: The Sattely Synthesis of Momilactone

Chemexpress March 22, 2024 0 Comments

Arnaud Voituriez of the Université Paris-Saclay used a cyclic phosphine to mediate the assembly of the cyclobutene 3 by the addition of the β-diketone 1 to the acetylene dicarboxylate 2…

Uncategorized

C-O Ring Construction: Triciadolide C (Wang), Nesteretal A (Ito), Toxicodenane (Han), Dehydro-exo-Brevicomin (Kanomata), Diocollettines A (Houk/Smith), Heliannuol K (Green)

Chemexpress March 22, 2024 0 Comments

The maleic anhydride derivative triciadolide C (3) was isolated from the aquatic hyphomycete Tricladium castaneicola. PMID:23460641 Shaozhong Wang of Nanjing University developed a general route to such anhydrides, exemplified by…

Uncategorized

Functional Group Protection: The Murai/Arisawa Synthesis of Ansellone A

Chemexpress March 22, 2024 0 Comments

John C. Jewett of the University of Arizona demonstrated that the protected diazonium salt 1 participated efficiently in Suzuki coupling, leading the biphenyl 2 (Org. Lett. 2021, 23, 1851. DOI:…

Uncategorized

Post. This study confirmed the protective effect of butorphanol postC on

Chemexpress March 21, 2024 0 Comments

Post. This study confirmed the protective impact of butorphanol postC on ischaemic myocardium in reperfusion injury. We used 50 g kg1 of butorphanol primarily based on our earlier report that…

Uncategorized

The cells had been transfected with TRPC3 siRNA as described above and

Chemexpress March 21, 2024 0 Comments

The cells have been transfected with TRPC3 siRNA as described above and starved overnight before incubation with FSH for an added 48 hr. Cisplatin was added at a final concentration…

Uncategorized

Enantioselective Synthesis of Alcohols and Amines: The Yang Synthesis of Colchicine

Chemexpress March 21, 2024 0 Comments

Guosheng Liu of the Shanghai Institute of Organic Chemistry devised the enantioselective Pd-catalyzed diacetoxylation of the alkene 1 to the bis-acetate 2 (Nature Catal. 2021, 4, 172. DOI: 10.1038/s41929-021-00574-5). Bingxian…

Uncategorized

Diastereoselective and Enantioselective Construction of Cyclic Ethers

Chemexpress March 21, 2024 0 Comments

Because the stereocontrolled construction of cyclic ethers has been difficult and expensive, the use of cyclic ethers as pharmaceuticals has not been fully explored. 1,2,3,4-Tetrahydrobenzoquinoline Chemical name With the development…

Posts pagination

1 … 93 94 95 … 101

« Previous Page — Next Page »

Recent Posts

  • Age). Similarly, a rise of ATX mRNA expression was observed in
  • Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages
  • Lity of detecting an association with homocysteine, if any. The mechanism
  • three). Nonetheless, there was only a tendency to minimize the combined incidences
  • TCCCTGCCAGATATCGAC GATGCACAGCAGGAGGATTT TACCATCTACCTGGGCTTCG CCATTCTGATTTGCTGCCTTAT GATCTCAGTGCAGAGGCTCG CCTTCCTGCTGCGGTTCA ATACCGGCACGAGACCGATAGTCA ATCAAACCCCCTGCAAGTGT AGCTGCTCAAGGCTTCCTTAT GACCCCAAGGAGATCACATTCACG GGCTAGAAATCTGCCTGTGC

Recent Comments

  1. A WordPress Commenter on Hello world!

You Missed

Uncategorized

Age). Similarly, a rise of ATX mRNA expression was observed in

Uncategorized

Bserved pronounced uptake of M1 into endothelial cells and monocytes/macrophages

Uncategorized

Lity of detecting an association with homocysteine, if any. The mechanism

Uncategorized

three). Nonetheless, there was only a tendency to minimize the combined incidences

Targetedlibrary

Copyright © All rights reserved | Blogus by Themeansar.